Neuropeptide Y cDNA ORF Clone, Human, untagged

Cat: HG10946-M-N

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Neuropeptide Y Reagents

CRO Services


All Neuropeptide Y Reagents

Neuropeptide Y cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
294 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for two point mutations: 150G/A and 204C/T not causing the amino acid variation.
Description
Full length Clone DNA of Human neuropeptide Y DNA.

Plasmid

Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Neuropeptide Y cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Neuropeptide Y cDNA ORF Clone, Human, untagged Alternative Names

PYY4 cDNA ORF Clone, Human

Neuropeptide Y Background Information

Neuropeptide Y (NPY) is a neuromodulator that is widely expressed throughout the central nervous system (CNS) and which is cosecreted with classic neurotransmitters including GABA and glutamate. Neuropeptide Y (NPY)/Agouti-related protein (AgRP) neurons in the arcuate nucleus of the hypothalamus are part of a neuroendocrine feedback loop that regulates feeding behavior and glucose homeostasis. NPY/AgRP neurons sense peripheral signals (including the hormones leptin, insulin, and ghrelin) and integrate those signals with inputs from other brain regions.Neuropeptide Y (NPY) plays different roles in mammals such as: regulate food intake, memory retention, cardiovascular functions, and anxiety.
Full Name
neuropeptide Y

Neuropeptide Y cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Neuropeptide Y cDNA ORF Clone in Cloning Vector, Mouse MG51013-G
Neuropeptide Y cDNA ORF Clone, Mouse, untagged MG51013-UT
Neuropeptide Y Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51013-ACGLN
Neuropeptide Y cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51013-ACG
Neuropeptide Y cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51013-ACR
Neuropeptide Y cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51013-CF
Neuropeptide Y cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51013-NF
Neuropeptide Y cDNA ORF Clone, Mouse, C-His tag MG51013-CH
Neuropeptide Y cDNA ORF Clone, Mouse, N-His tag MG51013-NH
Neuropeptide Y cDNA ORF Clone, Mouse, C-HA tag MG51013-CY
Neuropeptide Y cDNA ORF Clone, Mouse, N-HA tag MG51013-NY
Neuropeptide Y cDNA ORF Clone, Mouse, C-Myc tag MG51013-CM
Neuropeptide Y cDNA ORF Clone, Mouse, N-Myc tag MG51013-NM
Neuropeptide Y qPCR Primer Pairs, Mouse MP200973

Neuropeptide Y cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Neuropeptide Y cDNA ORF Clone in Cloning Vector, Human HG10946-M
Neuropeptide Y cDNA ORF Clone, Human, untagged HG10946-UT
Neuropeptide Y cDNA ORF Clone, Human, C-GFPSpark® tag HG10946-ACG
Neuropeptide Y Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10946-ACGLN
Neuropeptide Y cDNA ORF Clone, Human, C-OFPSpark® tag HG10946-ACR
Neuropeptide Y cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10946-CF
Neuropeptide Y cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10946-NF
Neuropeptide Y cDNA ORF Clone, Human, C-His tag HG10946-CH
Neuropeptide Y cDNA ORF Clone, Human, N-His tag HG10946-NH
Neuropeptide Y cDNA ORF Clone, Human, C-HA tag HG10946-CY
Neuropeptide Y cDNA ORF Clone, Human, N-HA tag HG10946-NY
Neuropeptide Y cDNA ORF Clone, Human, C-Myc tag HG10946-CM
Neuropeptide Y cDNA ORF Clone, Human, N-Myc tag HG10946-NM
Neuropeptide Y qPCR Primer Pairs, Human HP100823
info info
添加购物车成功! 添加购物车失败!