PDGFRA cDNA ORF Clone, Human, untagged

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

PDGFRA cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3270 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 516 C/T, 1701 A/G, 3222 T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human platelet-derived growth factor receptor, alpha polypeptide.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
HindIII + XhoI (5.5kb + 3.27kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

PDGFRA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PDGFRA cDNA ORF Clone, Human, untagged: Alternative Names

CD140A cDNA ORF Clone, Human; PDGFR-2 cDNA ORF Clone, Human; PDGFR2 cDNA ORF Clone, Human; RHEPDGFRA cDNA ORF Clone, Human

PDGFRA Background Information

PDGFRA, also known as CD14a, together with the structurally homolog protein PDGFRB (CD14b), are cell surface receptors for members of the platelet-derived growth factor family. They are members of the class III subfamily of receptor tyrosine kinase (RTKs) with the similar structure characteristics of five immunoglobulin-like domains in their extracellular region and a split kinase domain in their intracellular region. PDGFRA is expressed in oligodendrocyte progenitor cells and mesothelial cell, and binds all three ligand isoforms PDGF-AA, PDGF-BB and PDGF-AB with high affinity, whereas PDGFRB dose not bind PDGF-AA. PDGFRA plays an essential role in regulating proliferation, chemotaxis and migration of mesangial cells. Recent studies have indicated that PDGFRA acts as a critical mediator of signaling in testis organogenesis and Leydig cell differentiation, and in addition, particularly important for kidney development. Additionally, PDGFRA is involved in tumor angiogenesis and maintenance of the tumor microenvironment and has been implicated in development and metastasis of Hepatocellular carcinoma (HCC). PDGFRA may represent a potential therapeutic target in thymic tumours. PDGFRA gene amplification rather than gene mutation may be the underlying genetic mechanism driving PDGFRA overexpression in a portion of gliomas.
Full Name
platelet-derived growth factor receptor, alpha polypeptide
References
  • Oseini AM, et al. (2009) PDGFRalpha: a new therapeutic target in the treatment of hepatocellular carcinoma? Expert Opin Ther Targets. 13(4): 443-54.
  • Meister M, et al. (2009) Expression and mutational status of PDGFR in thymic tumours. Anticancer Res. 29(10): 4057-61.
  • Martinho O, et al. (2009) Expression, mutation and copy number analysis of platelet-derived growth factor receptor A (PDGFRA) and its ligand PDGFA in gliomas. Br J Cancer. 101(6): 973-82.

PDGFRA cDNA ORF Clone, Rhesus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait