ROR1 cDNA ORF Clone, Human, C-HA tag

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

ROR1 cDNA ORF Clone, Human, C-HA tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2814 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations 180 C/T, 1170 G/T, 1353 A/G not causing the amino acid variation.
Description
Full length Clone DNA of Human receptor tyrosine kinase-like orphan receptor 1 with HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-HA
Restriction Sites
KpnI + XhoI (5.5kb + 2.84kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

ROR1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ROR1 cDNA ORF Clone, Human, C-HA tag: Validated Images

ROR1 cDNA ORF Clone, Human, C-HA tag: Alternative Names

dJ537F10.1 cDNA ORF Clone, Human; NTRKR1 cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait