CD32B / Fcgr2b cDNA ORF Clone, Rabbit, N-Myc tag

Price:
Size:
Number:

CD32B / Fcgr2b cDNA ORF Clone, Rabbit, N-Myc tag: General Information

Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
1098 bp
Description
Full length Clone DNA of Rabbit Fc fragment of IgG, low affinity IIb, receptor (CD32) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CD32B / Fcgr2b cDNA ORF Clone, Human, Related Products

CD32B / Fcgr2b cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait