FH / Fumarate Hydratase cDNA ORF Clone, Rabbit, N-Myc tag

Price:
Size:
Number:

FH / Fumarate Hydratase cDNA ORF Clone, Rabbit, N-Myc tag: General Information

Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
1527 bp
Description
Full length Clone DNA of Rabbit fumarate hydratase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FH / Fumarate Hydratase Background Information

Fumarate Hydratase (FH) is an enzymatic component of the tricarboxylic acid (TCA) cycle, or Krebs cycle, and catalyzes the formation of L-malate from fumarate. It exists in both a cytosolic form and an N-terminal extended form, differing only in the translation start site used. The N-terminal extended form is targeted to the mitochondrion, where the removal of the extension generates the same form as in the cytoplasm. Fumarate Hydratase is similar to some thermostable class II fumarases and functions as a homotetramer. Mutations in this gene can cause fumarase deficiency and lead to progressive encephalopathy. Individuals with hemizygous germline fumarate hydratase (FH) mutations are predisposed to renal cancer. These tumors predominantly exhibit functional inactivation of the remaining wild-type allele, implicating FH inactivation as a tumor-promoting event.
Full Name
fumarate hydratase
References
  • King A, et al. (2005) Succinate dehydrogenase and fumarate hydratase: linking mitochondrial dysfunction and cancer. Oncogene. 25(34): 4675-82.
  • Alam NA, et al. (2003) Genetic and functional analyses of FH mutations in multiple cutaneous and uterine leiomyomatosis, hereditary leiomyomatosis and renal cancer, and fumarate hydratase deficiency. Hum Mol Genet.12(11): 1241-52.
  • Pollard PJ, et al. (2003) The TCA cycle and tumorigenesis: the examples of fumarate hydratase and succinate dehydrogenase. Ann Med. 35(8): 632-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait