UCHL1 cDNA ORF Clone, Rabbit, N-Myc tag

Price:
Size:
Number:

UCHL1 cDNA ORF Clone, Rabbit, N-Myc tag: General Information

Gene
Species
Rabbit
NCBI Ref Seq
RefSeq ORF Size
672 bp
Description
Full length Clone DNA of Rabbit ubiquitin carboxyl-terminal esterase L1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

UCHL1 Background Information

Ubiquitin carboxyl-terminal hydrolase isozyme L1, also known as UCH-L1, Ubiquitin thioesterase L1, PGP9.5 and UCHL1, is a deubiqutinating enzyme with important functions in recycling of ubiquitin. Regulated proteolysis by the ubiquitin pathway has been implicated in control of the cell cycle, transcriptional activation, cell fate and growth, and synaptogenesis. The ubiquitin-proteasome system is involved in synaptic plasticity and is proposed to be part of a molecular switch that converts short-term synaptic potentiation to long-term changes in synaptic strength. UCHL1 is found in neuronal cell bodies and processes throughout the neocortex (at protein level). It is expressed in neurons and cells of the diffuse neuroendocrine system and their tumors. UCHL1 is weakly expressed in ovary. UCHL1 is a ubiquitin-protein hydrolase. It is involved both in the processing of ubiquitin precursors and of ubiquitinated proteins. This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. UCHL1 also binds to free monoubiquitin and may prevent its degradation in lysosomes. The homodimer of UCHL1 may have ATP-independent ubiquitin ligase activity. UCHL1 dysfunction has been associated with neurodegeneration in Parkinson's, Alzheimer's, and Huntington's disease patients. Reduced UCHL1 function may jeopardize the survival of CNS neurons.
Full Name
ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
References
  • Wada H., et al., 1998, Biochem. Biophys. Res. Commun. 251:688-92.
  • Choi J., et al., 2004, J. Biol. Chem. 279:13256-64.
  • Lombardino,A.2005, et al., J.Proc Natl Acad Sci.USA102 (22):8036-41
  • Okochi-Takada,E. et al., 2006, Int J Cancer. 119 (6):1338-44.
  • Zetterberg, M. et al., 2010, Mol Neurodegener  5 :11.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait