Commande rapide

Rat ADSL ORF mammalian expression plasmid, N-Flag tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat ADSL Informations sur les produits clonés de cDNA
Taille du ADNc:1455bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus adenylosuccinate lyase with N terminal Flag tag.
Synonyme du gène:null
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Adenylosuccinate lyase, also known as adenylosuccinase, ADSL or ASL, is an enzyme implicated in the reaction of adenylosuccinat converting to AMP and fumarate as part of the purine nucleotide cycle. The two substates of adenylosuccinate lyase (ADSL) are dephosphorylated derivatives of SAICA ribotide (SAICAR) and adenylosuccinate (S-AMP), which catalyzes an important reaction in the de novo pathway of purine biosynthesis. ADSL catalyzes two distinct reactions in the synthesis of purine nucleotides, both of which involve the _-elimination of fumarate to produce either aminoimidazole carboxamide ribotide from SAICAR or AMP from S-AMP. The Adenylosuccinate lyase deficiency is a rare autosomal recessive metabolic disorder characterized by the present of SAICA riboside and succinyladenosine (S-Ado). ADSL defect in different patients is often caused by different mutations to the enzyme.

  • Nassogne M, et al. (2000) Adenylosuccinase deficiency: an unusual cause of early-onset epilepsy associated with acquired microcephaly. Brain and development. 22 (6): 383-6.
  • Sivendran S, et al. (2004) Two novel mutant human adenylosuccinate lyases (ASLs) associated with autism and characterization of the equivalent mutant Bacillus subtilis ASL. J Biol Chem. 279 (51): 53789-97.
  • Lee TT, et al. (1999) His68 and His141 are critical contributors to the intersubunit catalytic site of adenylosuccinate lyase of Bacillus subtilis. Biochemistry. 38 (1): 22-32.
  • Size / Price
    Catalogue : RG81324-NF
    Prix catalogue :   (Save )
    Prix :      [How to order]
     Instructions d’expédition
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.