Annexin V / ANXA5 cDNA ORF Clone, Rat, C-Myc tag

Price:
Size:
Number:

Annexin V / ANXA5 cDNA ORF Clone, Rat, C-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
960 bp
Description
Full length Clone DNA of Rat annexin A5 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Annexin V / ANXA5 Background Information

The placental anticoagulant protein Annexin A5 (ANXA5) is a multifunctional protein that is highly expressed on the apical surfaces of syncytiotrophoblasts, and plays an important role in haemostatic regulations, maintaining blood fluidity of the placenta. Annexin A5 (ANXA5) is a protein abundantly expressed in normal placenta where it contributes to the healthy outcome of a pregnancy. Lower ANXA5 levels have been observed in M2/ANXA5 haplotype carrying chorion. The association found between the maternal carriage of the M2/ANXA5 haplotype and an elevated risk of IUGR and/or PE supports the hypothesis that carrier status of this haplotype and the consequently reduced placental ANXA5 expression might be responsible, at least partially, for the onset of these gestational vascular complications. ANXA5 could be used as a biomarker for the early detection of PE and for the prediction of its severity. ANXA5 as an embryonic anticoagulant that appears deficient in contiguous specter of thrombophilia-related pregnancy complications culminating more frequently in miscarriage in a maternal M2 carrier background. As a potential indicator for malignancy and lymphatic metastasis, ANXA5 overexpression increases in vitro migration and invasion of Hca-P cell, promotes in vivo malignancy, LNM rate and level of Hca-P-transplanted mice. Hereditary thrombophilias can impair vascular placental functions and predispose to the birth of small-for-gestational age (SGA) babies. The placental anticoagulant protein annexin A5 (ANXA5) may contribute to this process. A functional haplotype (M2) within the ANXA5 gene is associated with fetal loss and venous thrombosis.
Full Name
annexin A5
References
  • Cederholm A, et al. (2007) Annexin A5 as a novel player in prevention of atherothrombosis in SLE and in the general population. Ann N Y Acad Sci. 1108: 96-103.
  • Schlaepfer DD, et al. (1992) Inhibition of Protein Kinase C by AnnexinⅤ. Biochemistry. 31: 1886-91.
  • Vermes I, et al. (1995) A novel assay for apoptosis-flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labelled Annexin Ⅴ. J Immunol Methods. 184 (1): 39-51.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait