BNIP3L cDNA ORF Clone, Rat, N-HA tag

Price:
Size:
Number:

BNIP3L cDNA ORF Clone, Rat, N-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
657 bp
Description
Full length Clone DNA of Rat BCL2/adenovirus E1B interacting protein 3-like with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BNIP3L Background Information

The deletion of BNIP3L results in retention of mitochondria during lens fiber cell remodeling, and that deletion of BNIP3L also results in the retention of endoplasmic reticulum and Golgi apparatus. BNIP3L localizes to the endoplasmic reticulum and Golgi apparatus of wild-type newborn mouse lenses and is contained within mitochondria, endoplasmic reticulum and Golgi apparatus isolated from adult mouse liver. As the cells become packed with keratin bundles, Bnip3L expression triggers mitophagy to rid the cells of the last remaining 'living' characteristic, thus completing the march from 'living' to 'dead' within the hair follicle. during retinal development tissue hypoxia triggers HIF1A/HIF-1 stabilization, resulting in increased expression of the mitophagy receptor BNIP3L/NIX. BNIP3L-dependent mitophagy results in a metabolic shift toward glycolysis essential for RGC neurogenesis. BNIP3L could be a potential therapeutic target for ischemic stroke
Full Name
BCL2/adenovirus E1B 19kDa interacting protein 3-like
References
  • Imazu T, et al. (1999) Bcl-2 / E1B 19 kDa-interacting protein 3-like protein (Bnip3L) interacts with bcl-2 / Bcl-xL and induces apoptosis by altering mitochondrial membrane permeability. Oncogene. 18(32): 4523-9.
  • Sun JL, et al. (2004) Expression and structure of BNIP3L in lung cancer. Ai Zheng. 23(1): 8-14.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait