MIP-1 alpha / CCL3 cDNA ORF Clone, Rat, N-His tag

Price:
Size:
Number:

MIP-1 alpha / CCL3 cDNA ORF Clone, Rat, N-His tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
279 bp
Description
Full length Clone DNA of Rat chemokine (C-C motif) ligand 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

MIP-1 alpha / CCL3 Background Information

CCL3 is a cytokine belonging to the CC chemokine family. Chemokines are a family of structurally related leukocyte chemoattractant cytokines that play a central role during immunoregulatory and inflammation processes. All chemokines contain four conserved cysteines linked by disulfide bonds, and two major subfamilies, namely CXC and CC, are defined on the basis of the first two cysteines which are separated by one amino acid or are adjacent. CCL3 is involved in the acute inflammatory state in the recruitment and activation of polymorphonuclear leukocytes.
Full Name
chemokine (C-C motif) ligand 3
References
  • Zhao RY, et al. (2005) Viral infections and cell cycle G2/M regulation. Cell Res. 15(3):143-9. Joseph AM, et al. (2005) Nef: "necessary and enforcing factor" in HIV infection. Curr HIV Res. 3(1):87-94. Muthumani K, et al. (2004) HIV-1 Vpr and anti-inflammatory activity. DNA Cell Biol. 23(4): 239-47.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait