After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rat CD24 ORF mammalian expression plasmid, N-His tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat CD24 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_012752.3
Taille du ADNc:231bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus CD24 molecule with N terminal His tag.
Synonyme du gène:Cd24a, MGC93641, Cd24
Espèces:Rat
Vecteur:pCMV3-SP-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Cluster of differentiation 24, also known as signal transducer CD24 or heat stable antigen CD24 (HSA), is a mucin-type glycosylphosphatidylinositol-linked glycoprotein expressed on the surface of B-cells, differentiating neuroblasts and many tumors. It is involved in molecular adhesion and metastatic tumor spread and serve as a normal receptor for P-selectin. The CD24 / P-selectin pathway could be important in dissimenating of tumor cells by facilitating the interaction with platelet and endothelial cells. It has also been considered as a tumor marker. High rate of CD24 expressions have been found in epithelial ovarian cancer, breast cancer, non-small cell lung cancer, prostate cancer and pancreatic cancer.

Références
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Kristiansen G, et al. (2003) Tumour biological aspects of CD24, a mucin-like adhesion molecule. Journal of molecular histology. 35 (3): 255-62.
  • Size / Price
    Catalogue : RG80297-NH
    Prix catalogue :   (Save )
    Prix :      [How to order]
    Disponibilité
     Instructions d’expédition
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »