After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rat PD-L1/B7-H1/CD274 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat CD274 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001191954.1
Taille du ADNc:873bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus CD274molecule with N terminal HA tag.
Synonyme du gène:Pdcd1lg1, RGD1566211, Cd274
Espèces:Rat
Vecteur:pCMV3-SP-N-HA
Plasmid:
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fond

Programmed death-1 ligand-1 (PD-L1, CD274, B7-H1) has been identified as the ligand for the immunoinhibitory receptor programmed death-1(PD1/PDCD1) and has been demonstrated to play a role in the regulation of immune responses and peripheral tolerance. PD-L1/B7-H1 is a member of the growing B7 family of immune molecules and this protein contains one V-like and one C-like Ig domain within the extracellular domain, and together with PD-L2, are two ligands for PD1 which belongs to the CD28/CTLA4 family expressed on activated lymphoid cells. By binding to PD1 on activated T-cells and B-cells, PD-L1 may inhibit ongoing T-cell responses by inducing apoptosis and arresting cell-cycle progression. Accordingly, it leads to growth of immunogenic tumor growth by increasing apoptosis of antigen specific T cells and may contribute to immune evasion by cancers. PD-L1 thus is regarded as promising therapeutic target for human autoimmune disease and malignant cancers.

Références
  • Iwai Y, et al. (2002) Involvement of PD-L1 on tumor cells in the escape from host immune system and tumor immunotherapy by PD-L1 blockade. Proc Natl Acad Sci U S A. 99(19): 12293-7.
  • Ghebeh H, et al. (2006) The B7-H1 (PD-L1) T lymphocyte-inhibitory molecule is expressed in breast cancer patients with infiltrating ductal carcinoma: correlation with important high-risk prognostic factors. Neoplasia. 8(3): 190-8.
  • Salih HR, et al. (2006) The role of leukemia-derived B7-H1 (PD-L1) in tumor-T-cell interactions in humans. Exp Hematol. 34(7): 888-94.
  • Wilcox RA, et al. (2009) B7-H1 (PD-L1, CD274) suppresses host immunity in T-cell lymphoproliferative disorders. Blood. 114(10): 2149-58.
  • Ruggiero A, et al. (2009) Crystal structure of PD-L1, a ribosome inactivating protein from Phytolacca dioica L. leaves with the property to induce DNA cleavage. Biopolymers. 91(12): 1135-42.
  • Size / Price
    Catalogue : RG80450-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »