After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rat CD47 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat CD47 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_019195.2
Taille du ADNc:912bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus Cd47 molecule with N terminal His tag.
Synonyme du gène:Itgp, MGC93490, Cd47
Espèces:Rat
Vecteur:pCMV3-SP-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal cell binding domain of thrombospondin. It may play a role in membrane transport and signal transduction. CD47 is also a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. It is very broadly distributed on normal adult tissues, as well as ovarian tumors, being especially abundant in some epithelia and the brain. CD47 may play a role in membrane transport and/or integrin dependent signal transduction. It may prevent premature elimination of red blood cells. It also may be involved in membrane permeability changes induced following virus infection. By acting as an adhesion receptor for THBS1 on platelets, CD47 plays a role in both cell adhesion and in the modulation of integrins. It also plays an important role in memory formation and synaptic plasticity in the hippocampus.

Références
  • Brown EJ, et al. (2001) Integrin-associated protein (CD47) and its ligands. Trends Cell Biol. 11(3): 130-5.
  • Oldenborg PA. (2004) Role of CD47 in erythroid cells and in autoimmunity. Leuk Lymphoma. 45(7): 1319-27.
  • Kaczorowski DJ, et al. (2007) Targeting CD47: NO limit on therapeutic potential. Circ Res. 100(5): 602-3.
  • Size / Price
    Catalogue : RG80305-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »