After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Rat CD53 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat CD53 Informations sur les produits clonés de cDNA
Taille du ADNc:660bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus Cd53 molecule with C terminal His tag.
Synonyme du gène:OX44, Ox-44, RATOX44, Cd53
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

CD53 is a member of the transmembrane 4 superfamily, also called the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. These proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. CD53 is a cell surface glycoprotein that is known to complex with integrins. Familial deficiency of CD53 gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. CD53 contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation.

  • Rochelle JM, et al. (1993) Gene structure, chromosomal localization, and protein sequence of mouse CD53 (Cd53): evidence that the transmembrane 4 superfamily arose by gene duplication. Int Immunol. 5(2):209-16.
  • Virtaneva KI, et al. (1993) The genes for CD37, CD53, and R2, all members of a novel gene family, are located on different chromosomes. Immunogenetics. 37(6):461-5.
  • Horejsí V, et al. (1991) Novel structurally distinct family of leucocyte surface glycoproteins including CD9, CD37, CD53 and CD63. FEBS Lett. 288(1-2):1-4.
  • Size / Price
    Catalogue : RG80303-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.