Commande rapide

Text Size:AAA

Rat CD59 expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat CD59 Informations sur les produits clonés de cDNA
Taille du ADNc:381bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus CD59 molecule, complement regulatory protein with N terminal His tag.
Synonyme du gène:Cd59a, Cd59b, MACIF, MACIP, MAC-IP, Cd59
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

CD59 glycoprotein, also known as 20 kDa homologous restriction factor, HRF20, MAC-inhibitory protein, Membrane attack complex inhibition factor, Membrane inhibitor of reactive lysis, MIC11, MIRL and CD59, is a cell membrane protein which contains one UPAR/Ly6 domain. CD59 is a small, highly glycosylated, GPI-linked protein, with a wide expression profile. The soluble form of CD59 from urine retains its specific complement binding activity, but exhibits greatly reduced ability to inhibit MAC assembly on cell membranes. CD59 is a potent inhibitor of the complement membrane attack complex (MAC) action. CD59 was first identified as a regulator of the terminal pathway of complement. It acts by binding to the C8 and/or C9 complements of the assembling MAC, thereby preventing incorporation of the multiple copies of C9 required for complete formation of the osmolytic pore. This inhibitor appears to be species-specific. CD59 is involved in signal transduction for T-cell activation complexed to a protein tyrosine kinase. Defects in CD59 are the cause of CD59 deficiency (CD59D).

  • Fletcher CM. et al., 1994, Structure. 2: 185-99.
  • Rudd PM. et al., 1997, J Biol Chem. 272: 7229-44.
  • Kimberley FC. et al., 2007, Mol Immunol. 44 (1-3): 73-81.
  • Gong Y. et al., 2007, Sci China C Life Sci. 50 (6): 773-9.
  • Picariello G. et al., 2008, Proteomics 8: 3833-47.
  • Heibeck TH. et al., 2009, J Proteome Res. 8: 3852-61.
  • Size / Price
    Catalogue : RG80299-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.