SELL / CD62L cDNA ORF Clone, Rat, N-His tag

Price:
Size:
Number:

SELL / CD62L cDNA ORF Clone, Rat, N-His tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1119 bp
Description
Full length Clone DNA of Rat selectin L with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

SELL / CD62L Background Information

L-selectin (SELL), also known as CD62L, is a key adhesion molecule that regulates both the migration of leukocytes at sites of inflammation and the recirculation of lymphocytes between blood and lymphoid tissues. It belongs to the selectin family of proteins, and consisting of a large, highly glycosylated, extracellular domain, a single spanning transmembrane domain and a small cytoplasmic tail. L-selectin is the only selectin expressed on leukocytes and mediates a number of leukocyte-endothelial interactions. L-selectin acts as a "homing receptor" for leukocytes to enter secondary lymphoid tissues via high endothelial venules. Ligands present on endothelial cells will bind to leukocyte expressing L-selectin, slowing leukocyte trafficking through the blood, and facilitating entry into a secondary lymphoid organ at that point. L-selectin-mediated lymphocyte recirculation is required for maintaining the appropriate tissue distribution of lymphocyte subpopulations including naïve and effector subsets such as regulatory T cells. In addition, L-selectin-mediated entry into peripheral lymph nodes is required for optimal induction of lymphocyte homeostatic proliferation during lymphopenia. Importantly, L-selectin has been shown to have both adhesive and signaling functions during leukocyte migration. L-selectin has also been shown to mediate leukocyte recruitment during chronic inflammatory and autoimmune diseases and thus is a potential therapeutic target for drug development.
Full Name
selectin L
References
  • Smalley DM, et al. (2005) L-selectin: mechanisms and physiological significance of ectodomain cleavage. J Cell Mol Med. 9(2): 255-66.
  • Grailer JJ, et al. (2009) L-selectin: role in regulating homeostasis and cutaneous inflammation. J Dermatol Sci. 56(3): 141-7.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait