Commande rapide

Rat CD82/KAI-1 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat CD82 Informations sur les produits clonés de cDNA
Taille du ADNc:801bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus Cd82 molecule with C terminal HA tag.
Synonyme du gène:Kai1, Cd82
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
( We provide with CD82 qPCR primers for gene expression analysis, RP300302 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

CD82, also known as KAI-1, structurally belongs to tetraspanin family while categorised as metastasis suppressor gene on functional grounds. KAI1/CD82 is localized on cell membrane and form interactions with other tetraspanins, integrins and chemokines which are respectively responsible for cell migration, adhesion and signalling. Downregulation of CD82 expression is associated with the advanced stages of many human cancers and correlates with the acquisition of metastatic potential. Recent studies suggest that complex mechanisms underlie CD82 loss of function, including altered transcriptional regulation, splice variant production and post-translational protein modifications, and indicate a central role for CD82 in controlling metastasis as a 'molecular facilitator'. The loss of KAI1/CD82 expression in invasive and metastatic cancers is due to a complex, epigenetic mechanism that probably involves transcription factors such as NFkappaB, p53, and beta-catenin. A loss of KAI1 expression is also associated with the advanced stages of many human malignancies and results in the acquisition of invasive and metastatic capabilities by tumour cells. Thus, KAI1/CD82 is regarded as a wide-spectrum tumor metastasis suppressor.

  • Malik FA, et al. (2009) KAI-1/CD82, the molecule and clinical implication in cancer and cancer metastasis. Histol Histopathol. 24(4): 519-30.
  • Liu WM, et al. (2006) KAI1/CD82, a tumor metastasis suppressor. Cancer Lett. 240(2): 183-94.
  • Tonoli H, et al. (2006) CD82 metastasis suppressor gene: a potential target for new therapeutics? Trends Mol Med. 11(12): 563-70.
  • Jackson P, et al. (2005) KAI1 tetraspanin and metastasis suppressor. Int J Biochem Cell Biol. 37(3): 530-4.
  • Size / Price
    Catalogue : RG80332-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.