Commande rapide

Rat Cadherin-12/CDH12 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat CDH12 Informations sur les produits clonés de cDNA
Taille du ADNc:2385bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus cadherin 12 with C terminal His tag.
Synonyme du gène:RGD1566350, Cdh12
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name

Classic Cadherins represent a family of calcium-dependent homophilic cell-cell adhesion molecules. They confer strong adhesiveness to animal cells when they are anchored to the actin cytoskeleton via their cytoplasmic binding partners, catenins. The cadherin/catenin adhesion system plays key roles in the morphogenesis and function of the vertebrate and invertebrate nervous systems. Furthermore, this system is involved in synaptic plasticity. Recent studies on the role of individual cadherin subtypes at synapses indicate that individual cadherin subtypes play their own unique role to regulate synaptic activities. Type II (atypical) cadherins are defined based on their lack of an HAV cell adhesion recognition sequence specific to type I cadherins. It has been observed that cells containing a specific cadherin subtype tend to cluster together to the exclusion of other types, both in cell culture and during development. Cadherin-12 also known as CDH12, is a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Cadherin-12 appears to be expressed specifically in the brain and its temporal pattern of expression would be consistent with a role during a critical period of neuronal development, perhaps specifically during synaptogenesis.

  • Tanihara H, et al. (1994) Cloning of five human cadherins clarifies characteristic features of cadherin extracellular domain and provides further evidence for two structurally different types of cadherin. Cell Adhes Commun. 2(1): 15-26.
  • Suzuki SC, et al. (2008) Cadherins in neuronal morphogenesis and function. Dev Growth Differ. 50 Suppl 1: S119-30.
  • Size / Price
    Catalogue : RG80279-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.