CDH12 cDNA ORF Clone, Rat, N-His tag

Cat: RG80279-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CDH12 Reagents
CRO Services
Product recommended

All CDH12 Reagents
CDH12 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2385 bp
Description
Full length Clone DNA of Rat cadherin 12 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDH12 Background Information

Classic Cadherins represent a family of calcium-dependent homophilic cell-cell adhesion molecules. They confer strong adhesiveness to animal cells when they are anchored to the actin cytoskeleton via their cytoplasmic binding partners, catenins. The cadherin/catenin adhesion system plays key roles in the morphogenesis and function of the vertebrate and invertebrate nervous systems. Furthermore, this system is involved in synaptic plasticity. Recent studies on the role of individual cadherin subtypes at synapses indicate that individual cadherin subtypes play their own unique role to regulate synaptic activities. Type II (atypical) cadherins are defined based on their lack of an HAV cell adhesion recognition sequence specific to type I cadherins. It has been observed that cells containing a specific cadherin subtype tend to cluster together to the exclusion of other types, both in cell culture and during development. Cadherin-12 also known as CDH12, is a type II classical cadherin from the cadherin superfamily of integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Cadherin-12 appears to be expressed specifically in the brain and its temporal pattern of expression would be consistent with a role during a critical period of neuronal development, perhaps specifically during synaptogenesis.

Full Name
cadherin 12, type 2 (N-cadherin 2)
References
  • Tanihara H, et al. (1994) Cloning of five human cadherins clarifies characteristic features of cadherin extracellular domain and provides further evidence for two structurally different types of cadherin. Cell Adhes Commun. 2(1): 15-26.
  • Suzuki SC, et al. (2008) Cadherins in neuronal morphogenesis and function. Dev Growth Differ. 50 Suppl 1: S119-30.
  • CDH12 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CDH12 cDNA ORF Clone in Cloning Vector, Rhesus CG90142-G
    CDH12 cDNA ORF Clone, Rhesus, untagged CG90142-UT
    CDH12 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90142-ACG
    CDH12 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90142-ACGLN
    CDH12 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90142-ACR
    CDH12 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90142-CF
    CDH12 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90142-NF
    CDH12 cDNA ORF Clone, Rhesus, C-His tag CG90142-CH
    CDH12 cDNA ORF Clone, Rhesus, N-His tag CG90142-NH
    CDH12 cDNA ORF Clone, Rhesus, C-HA tag CG90142-CY
    CDH12 cDNA ORF Clone, Rhesus, N-HA tag CG90142-NY
    CDH12 cDNA ORF Clone, Rhesus, C-Myc tag CG90142-CM
    CDH12 cDNA ORF Clone, Rhesus, N-Myc tag CG90142-NM

    CDH12 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CDH12 cDNA ORF Clone in Cloning Vector, Rat RG80279-G
    CDH12 cDNA ORF Clone, Rat, untagged RG80279-UT
    CDH12 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80279-ACGLN
    CDH12 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80279-ACG
    CDH12 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80279-ACR
    CDH12 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80279-CF
    CDH12 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80279-NF
    CDH12 cDNA ORF Clone, Rat, C-His tag RG80279-CH
    CDH12 cDNA ORF Clone, Rat, C-HA tag RG80279-CY
    CDH12 cDNA ORF Clone, Rat, N-HA tag RG80279-NY
    CDH12 cDNA ORF Clone, Rat, C-Myc tag RG80279-CM
    CDH12 cDNA ORF Clone, Rat, N-Myc tag RG80279-NM
    CDH12 qPCR Primer Pairs, Rat RP300258

    CDH12 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CDH12 cDNA ORF Clone in Cloning Vector, Human HG10317-M
    CDH12 cDNA ORF Clone, Human, untagged HG10317-UT
    CDH12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10317-ACGLN
    CDH12 cDNA ORF Clone, Human, C-GFPSpark® tag HG10317-ACG
    CDH12 cDNA ORF Clone, Human, C-OFPSpark® tag HG10317-ACR
    CDH12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10317-CF
    CDH12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10317-NF
    CDH12 cDNA ORF Clone, Human, C-His tag HG10317-CH
    CDH12 cDNA ORF Clone, Human, N-His tag HG10317-NH
    CDH12 cDNA ORF Clone, Human, C-HA tag HG10317-CY
    CDH12 cDNA ORF Clone, Human, N-HA tag HG10317-NY
    CDH12 cDNA ORF Clone, Human, C-Myc tag HG10317-CM
    CDH12 cDNA ORF Clone, Human, N-Myc tag HG10317-NM
    CDH12 qPCR Primer Pairs, Human HP100046
    info info
    添加购物车成功! 添加购物车失败!