CDK4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

1/1
Price:
Size:
Number:

CDK4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
951 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat cyclin-dependent kinase 4 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII + NotI(6kb+0.95kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CDK4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDK4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag: Validated Images

CDK4 Background Information

CDK4 is a member of the Ser/Thr protein kinase family. It is highly similar to the gene products of S. cerevisiae cdc28 and S. pombe cdc2. It is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression. The activity of CDK4 is restricted to the G1-S phase, which is controlled by the regulatory subunits D-type cyclins and CDK inhibitor p16(INK4a). CDK4 was shown to be responsible for the phosphorylation of retinoblastoma gene product. CDK4 is the ser/Thr-kinase component of cyclin D-CDK4 (DC) complexes that phosphorylate and inhibit members of the retinoblastoma (RB) protein family including RB1 and regulate the cell-cycle during G(1)/S transition. Phosphorylation of RB1 allows dissociation of the transcription factor E2F from the RB/E2F complexes and the subsequent transcription of E2F target genes which are responsible for the progression through the G(1) phase. Hypophosphorylates RB1 in early G(1) phase. Cyclin D-CDK4 complexes are major integrators of various mitogenenic and antimitogenic signals. CDK4 has been shown to be mutated in some types of cancer, whilst a chromosomal rearrangement can lead to Cdk6 overexpression in lymphoma, leukemia and melanoma.
Full Name
cyclin-dependent kinase 4
References
  • Stepanova L, et al. (1996) Mammalian p50Cdc37 is a protein kinase-targeting subunit of Hsp90 that binds and stabilizes Cdk4. Genes Dev. 10(12):1491-502.
  • Lamphere L, et al. (1997) Interaction between Cdc37 and Cdk4 in human cells. Oncogene. 14(16): 1999-2004.
  • Dai K, et al. (1996) Physical interaction of mammalian CDC37 with CDK4. J Biol Chem. 271(36): 22030-4.
  • Sugimoto M, et al. (1999) Regulation of CDK4 activity by a novel CDK4-binding protein, p34SEI-1. Genes Dev. 13(22):3027-33.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait