After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rat CFH natural ORF mammalian expression plasmid

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat CFH Informations sur les produits clonés de cDNA
Gene_bank_ref_id:BC089845.1
Taille du ADNc:1182bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus complement factor H.
Synonyme du gène:Fh
Espèces:Rat
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

Complement factor H, also known as H factor 1, and CFH, is a sialic acid containing glycoprotein that plays an integral role in the regulation of the complement-mediated immune system that is involved in microbial defense, immune complex processing, and programmed cell death. Factor H protects host cells from injury resulting from unrestrained complement activation. CFH regulates complement activation on self cells by possessing both cofactor activity for the Factor I mediated C3b cleavage, and decay accelerating activity against the alternative pathway C3 convertase, C3bBb. CFH protects self cells from complement activation but not bacteria/viruses. Due to the central role that CFH plays in the regulation of complement, there are many clinical implications arrising from aberrant CFH activity. Mutations in the Factor H gene are associated with severe and diverse diseases including the rare renal disorders hemolytic uremic syndrome (HUS) and membranoproliferative glomerulonephritis (MPGN) also termed dense deposit disease (DDD), membranoproliferative glomuleronephritis type II or dense deposit disease, as well as the more frequent retinal disease age related macular degeneration (AMD). In addition to its complement regulatory activities, factor H has multiple physiological activities and 1) acts as an extracellular matrix component, 2) binds to cellular receptors of the integrin type, and 3) interacts with a wide selection of ligands, such as the C-reactive protein, thrombospondin, bone sialoprotein, osteopontin, and heparin.

Références
  • Zipfel PF. (2001) Complement factor H: physiology and pathophysiology. Semin Thromb Hemost. 27(3): 191-9.
  • Zipfel PF, et al. (2008) The complement fitness factor H: role in human diseases and for immune escape of pathogens, like pneumococci. Vaccine. 26 Suppl 8: I67-74.
  • Ferreira VP, et al. (2010) Complement control protein factor H: the good, the bad, and the inadequate. Mol Immunol. 47(13): 2187-97.
  • Donoso LA, et al. (2010) The role of complement Factor H in age-related macular degeneration: a review. Surv Ophthalmol. 55(3): 227-46.
  • Size / Price
    Catalogue : RG81017-UT
    Prix catalogue :   (Save )
    Prix :      [How to order]
    Disponibilité2-3 weeksInstructions d’expédition
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »