Commande rapide

Text Size:AAA

Rat CLEC4B2 / mDCAR1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat CLEC4B2 Informations sur les produits clonés de cDNA
Taille du ADNc:627bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 4, member B2 with C terminal His tag.
Synonyme du gène:Aplra1, Clec4b2
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rat CLEC4B2 / mDCAR1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur on other vectors
Product nameProduct name

Clec4b2, also known as mDCAR1, is a member of the DCIR/DCAR family. Expression of Clec4b2 was strongly tissue dependent. Clec4b2 expression on DCs was restricted to the CD8(+) DC subset in spleen and thymus and on subpopulations of CD11b(+) myeloid cells in bone marrow and spleen, whereas the molecule was not detectable on both cell types in lymph nodes and peripheral blood. Clec4b2 is a functional receptor on cells of the immune system and provides further insights into the regulation of immune responses by CLRs.

  • Katayama S. et al., 2005, Science. 309 (5740): 1564-6.
  • Kaden SA. et al., 2009, J Immunol. 183 (8): 5069-78.
  • Skarnes WC. et al., 2011, Nature. 474 (7351): 337-42.
  • Size / Price
    Catalogue : RG80265-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.