After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rat CLEC5A / MDL1 / MDL-1 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat CLEC5A Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001109377.1
Taille du ADNc:573bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 5, member A.
Synonyme du gène:Clec5a
Espèces:Rat
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

CLEC5A, also known as MDL1 and MDL-1, is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. CLEC5A with dnax-activation protein 12 and may play a role in cell activation. It also functions as a positive regulator of osteoclastogenesis. CLEC5A acts as a key regulator of synovial injury and bone erosion during autoimmune joint inflammation .The binding of dengue virus to CLEC5A triggers signaling through the phosphylation of TYROBP, this interaction does not result in viral entry, but stimulates proinflammatory cytokine release.

Références
  • Chen ST. et al., 2008, Nature. 453 (7195): 672-6.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hillier LW. et al., 2003, Nature. 424 (6945): 157-64.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »