After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat Contactin 1/CNTN1 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat CNTN1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_057118.1
Taille du ADNc:3066bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus contactin 1 with C terminal His tag.
Synonyme du gène:F3, Cntn1
Espèces:Rat
Vecteur:pCMV3-C-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fond

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2 (TAG-1), Contactin-3 (BIG-1), BIG-2, Contactin-5 (NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-1 is a cell surface adhesion molecule that is normally expressed by neurons and oligodendrocytes. Particularly high levels of Contactin-1 are present during brain development. Contactin-1 and Contactin-2 are differentially expressed in a number of neuronal tissues during development, and they interact with several ligands including Nr-CAM, L1, NCAM, neurocan, phosphacan, and tenascin. As a cell adhesion molecule, Contactin-1 plays a role in the formation of axon connections in the developing nervous system. It was demonstrated that Contactin-1 participates in signal pathways via its association with Contactin-associated protein (CNTNAP1), receptor protein tyrosine phosphatase beta (RPTPb) and NOTCH1. Contactin-1 is also involved in paranodal axo-glial junction formation and oligodendrocytes generation. Furthermore, studies indicated that Contactin-1 functions importantly in the invasion and metastasis of lung adenocarcinoma cells. Contactin-1 may also significantly influence the functional expression and distribution of Na+ channels in neurons.

Références
  • Kazarinova NK, et al. (2001) Contactin associates with Na+ channels and increases their functional expression. J Neurosci. 21 (19):7517-25.
  • Eckerich C, et al. (2006) Contactin is expressed in human astrocytic gliomas and mediates repulsive effects. Glia. 53(1):1-12.
  • Su JL, et al. (2006) Knockdown of contactin-1 expression suppresses invasion and metastasis of lung adenocarcinoma. Cancer research 66 (5):2553-61.
  • Compton AG, et al. (2008) Mutations in contactin-1, a neural adhesion and neuromuscular junction protein, cause a familial form of lethal congenital myopathy. Am J Hum Genet. 83 (6):714-24.
  • Mikami T, et al. (2009) Contactin-1 is a functional receptor for neuroregulatory chondroitin sulfate-E. J Biol Chem. 284(7):4494-9.
  • Size / Price
    Catalogue : RG80315-CH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »