After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat CPA2 ORF mammalian expression plasmid, N-Myc tag

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat CPA2 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001013083.2
Taille du ADNc:1254bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus carboxypeptidase A2 (pancreatic) with N terminal Myc tag.
Synonyme du gène:Cpa2
Espèces:Rat
Vecteur:pCMV3-SP-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

Human Carboxypeptidase A2 ( CPA2 ) is a secreted pancreatic procarboxy -peptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group. The hydrolytic action of CPA2 was identified with a preference towards long substrates with aromatic amino acids in their C-terminal end, particularly tryptophan. CPA2 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. Three different forms of human pancreatic procarboxypeptidase A have been isolated, and the A1 and A2 forms are always secreted as monomeric proteins with different biochemical properties.

Références
  • Catasus, L. et al., 1995. J. Biol. Chem. 270: 6651-6657.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Laethem, RM. et al., 1996, Arch. Biochem. Biophys.332: 8-18.
  • Size / Price
    Catalogue : RG80715-NM
    Prix catalogue :   (Save )
    Prix :      [How to order]
    Disponibilité2-3 weeksInstructions d’expédition
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »