After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Commande rapide

Text Size:AAA

Rat CTHRC1 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat CTHRC1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001271300.1
Taille du ADNc:693bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus collagen triple helix repeat containing 1 with N terminal Myc tag.
Synonyme du gène:Cthrc1
Espèces:Rat
Vecteur:pCMV3-SP-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

Collagen triple helix repeat-containing protein 1, also known as Protein NMTC1, and CTHRC1, is a secreted protein that is glycosylated and highly conserved from lower chordates to mammals. CTHRC1 expression was not detectable in normal arteries. However, it is transiently expressed in the arterial wall in response to injury where it may contribute to vascular remodeling by limiting collagen matrix deposition and promoting cell migration. A short collagen motif with 12 Gly-X-Y repeats appears to be responsible for trimerization of the CTHRC1 protein and this renders the molecule susceptible to cleavage by collagenase. CTHRC1 overexpression caused a dramatic reduction in collagen type I mRNA and protein levels. Currently available data indicate that Cthrc1 expression in vascular cells regulates transforming growth factor beta responsiveness, thereby impacting transforming growth factor beta target genes, including collagens. Additionally, CTHRC1 increases bone mass as a positive regulator of osteoblastic bone formation and offers an anabolic approach for the treatment of osteoporosis.

Références
  • Pyagay P, et al. (2005) Collagen triple helix repeat containing 1, a novel secreted protein in injured and diseased arteries, inhibits collagen expression and promotes cell migration. Circ Res. 96(2): 261-8.
  • Durmus T, et al. (2006) Expression analysis of the novel gene collagen triple helix repeat containing-1 (Cthrc1). Gene Expr Patterns. 6(8): 935-40.
  • LeClair R, et al. (2007) The role of collagen triple helix repeat containing 1 in injured arteries, collagen expression, and transforming growth factor beta signaling. Trends Cardiovasc Med. 17(6): 202-5.
  • Kimura H, et al. (2008) Cthrc1 is a positive regulator of osteoblastic bone formation. PLoS One. 3(9): e3174.
  • Size / Price
    Catalogue : RG80712-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »