After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat Fractalkine/CX3CL1 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat CX3CL1 Informations sur les produits clonés de cDNA
Taille du ADNc:1182bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus chemokine (C-X3-C motif) ligand 1 with N terminal Flag tag.
Synonyme du gène:Cx3c, Scyd1, Cx3cl1
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Fractalkine or Chemokine (C-X3-C motif) ligand 1 (CX3CL1) is a member of the CX3C chemokine family. Fractalkine / CX3CL1 is a unique chemokine that functions not only as a chemoattractant but also as an adhesion molecule and is expressed on endothelial cells activated by proinflammatory cytokines, such as interferon-gamma and tumor necrosis factor-alpha. Fractalkine/CX3CL1 is expressed in a membrane-bound form on activated endothelial cells and mediates attachment and firm adhesion of T cells, monocytes and NK cells. Fractalkine / CX3CL1 is associated with dendritic cells (DC) in epidermis and lymphoid organs. The fractalkine receptor, CX3CR1, is expressed on cytotoxic effector lymphocytes, including natural killer (NK) cells and cytotoxic T lymphocytes, which contain high levels of intracellular perforin and granzyme B, and on macrophages. Soluble fractalkine causes migration of NK cells, cytotoxic T lymphocytes, and macrophages, whereas the membrane-bound form captures and enhances the subsequent migration of these cells in response to secondary stimulation with other chemokines.

  • Imai T, et al. (1997) Identification and molecular characterization of fractalkine receptor CX3CR1, which mediates both leukocyte migration and adhesion. Cell. 91(4): 521-30.
  • Papadopoulos EJ, et al. (1999) Fractalkine, a CX3C chemokine, is expressed by dendritic cells and is up-regulated upon dendritic cell maturation. Eur J Immunol. 29 (8): 2551-9.
  • Umehara H, et al. (2004) Fractalkine in vascular biology: from basic research to clinical disease". Arterioscler. Thromb Vasc Biol. 24 (1): 34-40.
  • Size / Price
    Catalogue : RG80163-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.