EphA4 cDNA ORF Clone, Rat, N-Myc tag

Price:
Size:
Number:

EphA4 cDNA ORF Clone, Rat, N-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2961 bp
Description
Full length Clone DNA of Rat Eph receptor A4 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EphA4 Background Information

EPH receptor A4 (ephrin type-A receptor 4), also known as EphA4, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA1, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. EphA4 is enriched on dendritic spines of pyramidal neurons in the adult mouse hippocampus, and ephrin-A3 is localized on astrocytic processes that envelop spines. Eph receptor−mediated signaling, which is triggered by ephrins7, probably modifies the properties of synapses during synaptic activation and remodeling. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). The extracellular domain of an EphA4 interacts with ephrin ligands, which may be tethered to neighbouring cells. Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer.
Full Name
EPH receptor A4
References
  • Murai KK, et al. (2003) Control of hippocampal dendritic spine morphology through ephrin-A3/EphA4 signaling. Nat Neurosci. 6(2): 153-60.
  • Kullander K, et al. (2003) Role of EphA4 and EphrinB3 in local neuronal circuits that control walking. Science. 299(5614): 1889-92.
  • Smith A, et al. (1997) The EphA4 and EphB1 receptor tyrosine kinases and ephrin-B2 ligand regulate targeted migration of branchial neural crest cells. Curr Biol. 7(8): 561-70.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait