EphB6 cDNA ORF Clone, Rat, N-Myc tag

Price:
Size:
Number:

EphB6 cDNA ORF Clone, Rat, N-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3042 bp
Description
Full length Clone DNA of Rat Eph receptor B6 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

EphB6 Background Information

Ephrins are divided into the ephrin-A (EFNA) class and the ephrin-B (EFNB) class based on their structures and sequence relationships. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. EphB6 is an unusual Eph receptor, lacking catalytic capacity due to alterations in its kinase domain. Interestingly, increased metastatic activity is associated with reduced EphB6 receptor expression in several tumor types, including breast cancer. This emphasizes the potential of EphB6 to act as a suppressor of cancer aggressiveness. EphB6 suppress cancer invasiveness through c-Cbl-dependent signaling, morphologic changes, and cell attachment and indicate that EphB6 may represent a useful prognostic marker and a promising target for therapeutic approaches. EphB6 can both positively and negatively regulate cell adhesion and migration, and suggest that tyrosine phosphorylation of the receptor by an Src family kinase acts as the molecular switch for the functional transition. In addition, Ephrin-B2 may be a physiological ligand for the EphB6 receptor.
Full Name
EPH receptor B6
References
  • Munthe E, et al. (2000)Ephrin-B2 is a candidate ligand for the Eph receptor, EphB6. FEBS Lett. 466(1): 169-74.
  • Matsuoka H, et al. (2005) Biphasic functions of the kinase-defective Ephb6 receptor in cell adhesion and migration. J Biol Chem. 280(32): 29355-63.
  • Truitt L, et al. (2010) The EphB6 receptor cooperates with c-Cbl to regulate the behavior of breast cancer cells. Cancer Res. 70(3): 1141-53.

EphB6 cDNA ORF Clone, Rhesus, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait