After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat Endothelial Cell Adhesion Molecule expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat ESAM Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001004245.1
Taille du ADNc:1185bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus endothelial cell adhesion molecule.
Synonyme du gène:MGC94065, Esam
Espèces:Rat
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Rat Endothelial Cell Adhesion Molecule expression plasmide de Gène l'ADNc ORF clone on other vectors
Product nameProduct name
Fond

Endothelial cell-selective adhesion molecule (ESAM) is a member of JAM family of immunoglobulin superfamily and consists of one V-type and one C2-type immunoglobulin domain, as well as a hydrophobic signal sequence, a single transmembrane region, and a cytoplasmic domain. It is specifically expressed at endothelial tight junctions and on activated platelets. ESAM at endothelial tight junctions participates in the migration of neutrophils through the vessel wall, possibly by influencing endothelial cell contacts. The adaptor protein membrane-associated guanylate kinase MAGI-1 has been identified as an intracellular binding partner of ESAM. Previous studies have indicated that ESAM regulates angiogenesis in the primary tumor growth and endothelial permeability. It suggest that ESAM has a redundant functional role in physiological angiogenesis but serves a unique and essential role in pathological angiogenic processes such as tumor growth.

Références
  • Ishida T, et al. (2003) Targeted disruption of endothelial cell-selective adhesion molecule inhibits angiogenic processes in vitro and in vivo. J Biol Chem. 278(36): 34598-604.
  • Wegmann F, et al. (2004) Endothelial adhesion molecule ESAM binds directly to the multidomain adaptor MAGI-1 and recruits it to cell contacts. Exp Cell Res. 300(1): 121-33.
  • Wegmann F, et al. (2006) ESAM supports neutrophil extravasation, activation of Rho, and VEGF-induced vascular permeability. J Exp Med. 203(7): 1671-7.
  • Hara T, et al. (2009) Endothelial cell-selective adhesion molecule regulates albuminuria in diabetic nephropathy. Microvasc Res. 77(3): 348-55.
  • Cangara HM, et al. (2010) Role of endothelial cell-selective adhesion molecule in hematogeneous metastasis. Microvasc Res. 80(1): 133-41.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »