After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat FTL Informations sur les produits clonés de cDNA
Taille du ADNc:552bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus ferritin, light polypeptide with N terminal HA tag.
Synonyme du gène:Ftl1
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurRG80491-ACGCHF270
Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurRG80491-ACRCHF270
Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurRG80491-ANGCHF270
Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurRG80491-ANRCHF270
Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurRG80491-CFCHF230
Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurRG80491-CHCHF230
Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurRG80491-CMCHF230
Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurRG80491-CYCHF230
Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurRG80491-NFCHF230
Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurRG80491-NHCHF230
Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurRG80491-NMCHF230
Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurRG80491-NYCHF230
Rat FTL/ferritin, light polypeptide Gène ADNc clone le vecteur de clonageRG80491-UCHF90
Rat FTL/ferritin, light polypeptide expression plasmide de Gène l'ADNc ORF cloneRG80491-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Ferritin, light polypeptide (FTL) is the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Storage of iron in the tissues occurs in the form of ferritin and hemosiderin. The latter originates from ferritin that has undergone intracellular digestion of its protein shell, leaving the iron core. Ferritin and hemosiderin are components of a continuum. Ferritin has been identified in all types of living organisms: animals, plants, molds, and bacteria. Whithin the protein shell of ferritin, iron is first oxidized to the ferric state for storage as ferric oxyhdroxide. Thus, ferritin removes excess iron from the cell sap where it could otherwise participate in peroxidation mechanisms.

  • Munro HN, et al. (1988) The ferritin genes: structure, expression, and regulation. Ann N Y Acad Sci. 526: 113-23.
  • Zhang Y, et al. (2008) Comparative proteomic analysis of human placenta derived from assisted reproductive technology. Proteomics. 8 (20): 4344-56.
  • Lebo RV, et al. (1986) Human ferritin light chain gene sequences mapped to several sorted chromosomes. Hum Genet. 71 (4): 325-8.
  • Size / Price
    Catalogue : RG80491-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.