Commande rapide

Text Size:AAA

Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat GLRX Informations sur les produits clonés de cDNA
Taille du ADNc:324bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus glutaredoxin (thioltransferase) with C terminal Flag tag.
Synonyme du gène:Grx, Glrx1
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF clone, C-Flag Marqueur on other vectors
Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurRG81101-ACGCHF270
Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurRG81101-ACRCHF270
Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurRG81101-ANGCHF270
Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurRG81101-ANRCHF270
Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurRG81101-CFCHF230
Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurRG81101-CHCHF230
Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurRG81101-CMCHF230
Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurRG81101-CYCHF230
Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurRG81101-NFCHF230
Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurRG81101-NHCHF230
Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurRG81101-NMCHF230
Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurRG81101-NYCHF230
Rat glutaredoxin-1 / GRX1 / GLRX Gène ADNc clone le vecteur de clonageRG81101-UCHF90
Rat glutaredoxin-1 / GRX1 / GLRX expression plasmide de Gène l'ADNc ORF cloneRG81101-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Glutaredoxin-1, also known as GRX1 and GLRX, belongs to the glutaredoxin family. Glutaredoxins are small redox enzymes that use glutathione as a cofactor. Glutaredoxins are oxidized by substrates, and reduced non-enzymatically by glutathione. Glutaredoxin-1 functions as an electron carrier in the glutathione-dependent synthesis of deoxyribonucleotides by the enzyme ribonucleotide reductase. Glutaredoxin-1 exists in either a reduced or an oxidized form. Glutaredoxins function as electron carriers in the glutathione-dependent synthesis of deoxyribonucleotides by the enzymeribonucleotide reductase.

  • Holmgren A. et al., 1988, FEMS Microbiol Rev. 4 (4): 271-97.
  • Holmgren A. 1988, Biochem Soc Trans. 16 (2): 95-6.
  • Holmgren A. 1989, J Biol Chem. 264 (24): 13963-6.
  • Size / Price
    Catalogue : RG81101-CF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.