Commande rapide

Text Size:AAA

Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat GOT1 Informations sur les produits clonés de cDNA
Taille du ADNc:1242bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) with N terminal HA tag.
Synonyme du gène:cCAT, Aspat, Gaspat, cAspAT
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur on other vectors
Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurRG80493-ACGCHF270
Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurRG80493-ACRCHF270
Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurRG80493-ANGCHF270
Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurRG80493-ANRCHF270
Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurRG80493-CFCHF230
Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurRG80493-CHCHF230
Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurRG80493-CMCHF230
Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurRG80493-CYCHF230
Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurRG80493-NFCHF230
Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurRG80493-NHCHF230
Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurRG80493-NMCHF230
Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurRG80493-NYCHF230
Rat Aspartate aminotransferase / GOT1 Gène ADNc clone le vecteur de clonageRG80493-UCHF90
Rat Aspartate aminotransferase / GOT1 expression plasmide de Gène l'ADNc ORF cloneRG80493-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name

Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    Catalogue : RG80493-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.