GOT2 cDNA ORF Clone, Rat, N-HA tag

Price:
Size:
Number:

GOT2 cDNA ORF Clone, Rat, N-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1293 bp
Description
Full length Clone DNA of Rat glutamic-oxaloacetic transaminase 2, mitochondrial with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GOT2 Background Information

GOT2 is a mitochondrial enzyme that oxidizes glutamate to produce alpha-ketoglutarate for the Krebs cycle, eventually leading to the production of adenosine triphosphate (ATP). GOT2-mediated ATP synthesis may be a pivotal mechanism underlying the protective effect of febuxostat against neurodegeneration in experimental autoimmune encephalomyelitis (EAE). The high aberrant GOT2 expression is prognostic in diffuse large B-cell lymphoma underscoring the current findings
Full Name
glutamic-oxaloacetic transaminase 2, mitochondrial
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait