Commande rapide

Rat HepaCAM2 expression plasmide de Gène l'ADNc ORF clone

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Rat HEPACAM2 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_001106580.2
    Taille du ADNc:1392bp
    Description du ADNc:Full length Clone DNA of Rattus norvegicus HEPACAM family member 2.
    Synonyme du gène:RGD1305697, Hepacam2
    Espèces:Rat
    Vecteur:pCMV3-untagged
    Plasmid:
    Site de restriction:
    Séquence du marqueur:
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HepaCAM2 qPCR primers for gene expression analysis, RP300228 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Fond

    HepaCAM2 belongs to the immunoglobulin family. HepaCAM2, together with HEPACAM1, are cell adhesion molecules. HEPACAM1 modulates cell adhesion and migration. It also inhibits cancer cell growth. HepaCAM2 contains 2 Ig-like C2-type (immunoglobulin-like) domains. The immunoglobulin domain is a type of protein domain that consists of a 2-layer sandwich of between 7 and 9 antiparallel β-strands arranged in two β-sheets with a Greek key topology. Members of the immunoglobulin superfamily are found in hundreds of proteins of different functions.

    Références
  • Moh MC, et al. (2008) Expression of hepaCAM is downregulated in cancers and induces senescence-like growth arrest via a p53/p21-dependent pathway in human breast cancer cells. Carcinogenesis. 29(12):2298-305.
  • Moh MC, et al. (2005) Structural and functional analyses of a novel ig-like cell adhesion molecule, hepaCAM, in the human breast carcinoma MCF7 cells. J Biol Chem. 280(29):27366-74.
  • Chung Moh M, et al. (2005) Cloning and characterization of hepaCAM, a novel Ig-like cell adhesion molecule suppressed in human hepatocellular carcinoma. J Hepatol. 42(6):833-41.
  • Size / Price
    Catalogue : RG80242-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »