IFITM2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Price:
Size:
Number:

IFITM2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
435 bp
Description
Full length Clone DNA of Rat interferon induced transmembrane protein 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IFITM2 Background Information

IFITM2 knockdown decreased GC cell proliferation, migration, invasion, and epithelial-to-mesenchymal transition in vitro. And IFITM2 expression was in part induced by insulin-like growth factor (IGF) 1 via IGF1 receptor/signal transducer and activator of transcription 3 signaling. Furthermore, IFITM2 regulated interleukin-6 expression and secretion, which in turn increased IFITM2 expression. Silencing of IFITM2 expression suppressed tumor growth and lung metastasis in vivo. That IFITM2 is a novel prognostic biomarker and regulator of GC progression.
Full Name
interferon induced transmembrane protein 2

IFITM2 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait