After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat IFITM3 expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat IFITM3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_001136124.1
Taille du ADNc:414bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus interferon induced transmembrane protein 3 with N terminal Myc tag.
Synonyme du gène:rat8, DSPA2b
Espèces:Rat
Vecteur:pCMV3-SP-N-Myc
Plasmid:
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Fond

Interferon-induced transmembrane protein 3 (IFITM3) belongs to the CD225 family. To replicate, viruses must gain access to the host cell's resources. Interferon (IFN) regulates the actions of a large complement of interferon effector genes (IEGs) that prevent viral replication. The interferon inducible transmembrane protein family members, IFITM1, 2 and 3, are IEGs required for inhibition of influenza A virus, dengue virus, and West Nile virus replication in vitro. IFITM3 is an IFN-induced antiviral protein that mediates cellular innate immunity to at least three major human pathogens, namely influenza A H1N1 virus, West Nile virus (WNV), and dengue virus (WNV), by inhibiting the early step(s) of replication. It is both necessary and sufficient for preventing the emergence of viral genomes from the endosomal pathway. Viral pseudoparticles were inhibited from transferring their contents into the host cell cytosol by IFN, and IFITM3 was required and sufficient for this action. IFITM3 overexpression is sufficient for this phenotype. Moreover, IFITM3 partially resides in late endosomal and lysosomal structures, placing it in the path of invading viruses.

Références
  • Tanaka SS, et al. (2005) IFITM/Mil/fragilis family proteins IFITM1 and IFITM3 play distinct roles in mouse primordial germ cell homing and repulsion. Dev Cell. 9(6):745-56.
  • Li D, et al. (2011) KLF4-mediated negative regulation of IFITM3 expression plays a critical role in colon cancer pathogenesis. Clin Cancer Res. 17(11):3558-68.
  • Lu J, et al. (2011) The IFITM proteins inhibit HIV-1 infection. J Virol. 85(5):2126-37.
  • Size / Price
    Catalogue : RG80739-NM
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »