Commande rapide

Rat IL-17F expression plasmide de Gène l'ADNc ORF clone, N-HA Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat IL17F Informations sur les produits clonés de cDNA
Taille du ADNc:462bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus interleukin 17F with N terminal HA tag.
Synonyme du gène:IL17F
Site de restriction:
Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Description de la séquence:
( We provide with IL17F qPCR primers for gene expression analysis, RP300427 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Interleukin-17F (IL-17F) is a cytokine that shares sequence similarity with IL17. The most notable role of IL-17 is it involvement in inducing and mediating proinflammatory responses. IL-17 is commonly associated with allergic responses. IL-17F is expressed by activated T cells, and was expressed only in activated CD4+ T cells and activated monocytes. IL-17F has been shown to stimulate the production of several other cytokines, including IL6 and IL8. This cytokine is also found to inhibit the angiogenesis of endothelial cells and induce endothelial cells to produce IL2, TGFB1/TGFB, and monocyte chemoattractant protein-1. Recombinant human IL-17F did not stimulate the proliferation of hematopoietic progenitors or the migration of mature leukocytes. However, it markedly inhibited the angiogenesis of human endothelial cells and induced endothelial cells to produce IL-2, TGF-{beta}, and monocyte chemoattractant protein-1. IL-17F stimulates the production of other cytokines and granulocyte colony-stimulating factor, and can regulate cartilage matrix turnover. IL-17F stimulates PBMC and T-cell proliferation. It also function in inhibiting angiogenesis By similarity. IL-17F plays a role in the induction of neutrophilia in the lungs and in the exacerbation of antigen-induced pulmonary allergic inflammation.

et al..
  • Starnes T, et al.. (2001) Cutting edge: IL-17F, a novel cytokine selectively expressed in activated T cells and monocytes, regulates angiogenesis and endothelial cell cytokine production. J Immunol. 167(8): 4137-40.
  • Hymowitz SG, et al.. (2001) IL-17s adopt a cystine knot fold: structure and activity of a novel cytokine, IL-17F, and implications for receptor binding. EMBO J. 20(19): 5332-41.
  • McAllister F, et al.. (2005) Role of IL-17A, IL-17F, and the IL-17 receptor in regulating growth-related oncogene-alpha and granulocyte colony-stimulating factor in bronchial epithelium: implications for airway inflammation in cystic fibrosis. J Immunol. 175(1): 404-12.
  • Size / Price
    Catalogue : RG80462-NY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Ajouter au panierBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.