Commande rapide

Text Size:AAA

Rat IL-17E/IL-25 expression plasmide de Gène l'ADNc ORF clone, N-Flag Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat IL25 Informations sur les produits clonés de cDNA
Taille du ADNc:510bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus interleukin 25 with N terminal Flag tag.
Synonyme du gène:RGD1561632, Il25
Site de restriction:
Séquence du marqueur:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Interleukin-25 (IL-25) is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. IL-25 is a member of the IL-17 family of cytokines. However, unlike the other members of this family, IL-25 promotes T helper (Th) 2 responses. IL-25 also regulates the development of autoimmune inflammation mediated by IL-17–producing T cells. IL-25 and IL-17, being members of the same cytokine family, play opposing roles in the pathogenesis of organ-specific autoimmunity. IL-25 promotes cell expansion and Th2 cytokine production when Th2 central memory cells are stimulated with thymic stromal lymphopoietin (TSLP)–activated dendritic cells (DCs), homeostatic cytokines, or T cell receptor for antigen triggering. Elevated expression of IL-25 and IL-25R transcripts was observed in asthmatic lung tissues and atopic dermatitis skin lesions, linking their possible roles with exacerbated allergic disorders. A plausible explanation that IL-25 produced by innate effector eosinophils and basophils may augment the allergic inflammation by enhancing the maintenance and functions of adaptive Th2 memory cells had been provided.

  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Tamachi T, et al.. (2006) IL-25 enhances allergic airway inflammation by amplifying a TH2 cell-dependent pathway in mice. J Allergy Clin Immunol. 118(3): 606-14.
  • Kleinschek MA, et al.. (2007) IL-25 regulates Th17 function in autoimmune inflammation. J Exp Med. 204(1): 161-70.
  • Size / Price
    Catalogue : RG80194-NF
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.