Commande rapide

Rat CD61/Integrin beta 3/ITGB3 expression plasmide de Gène l'ADNc ORF clone, C-His Marqueur

  • Rat CD61/Integrin beta 3/ITGB3 Gene Plasmid Map 17379
Fiche techniqueCommentairesProduits apparentésProtocoles
Rat ITGB3 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_153720.1
Taille du ADNc:2409 bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus integrin, beta 3 with C terminal His tag.
Synonyme du gène:Itgb3
Espèces:Rat
Vecteur:pCMV3-C-His
Plasmid:pCMV3-ratITGB3-His
Site de restriction:KpnI(two restriction sites) + XbaI(6kb+1.94kb+0.48)
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ITGB3 qPCR primers for gene expression analysis, RP300285 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catalogue : RG80312-CH
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
DisponibilitéIn Stock
Ajouter au panierBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »