Jagged 1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80419-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Jagged 1 Reagents

CRO Services

Product recommended


All Jagged 1 Reagents

Jagged 1 cDNA ORF Clone, Rat, N-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3660 bp
Description
Full length Clone DNA of Rat jagged 1 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Jagged 1 Background Information

Protein Jagged 1, also known as JAG1, JAGL1 and CD339, is a single-pass type I  membrane protein which contains 1 DSL domain and 15 EGF-like domains. JAG1/Jagged 1 is widely expressed in adult and fetal tissues. The expression of JAG1/Jagged 1 is up-regulated in cervical squamous cell carcinoma. JAG1/Jagged 1 is also expressed in bone marrow cell line HS-27a which supports the long-term maintenance of immature progenitor cells. JAG1/Jagged 1 is a ligand for multiple Notch receptors. It is involved in the mediation of Notch signaling. JAG1/Jagged 1 may be involved in cell-fate decisions during hematopoiesis.  JAG1/Jagged 1 seems to be involved in early and late stages of mammalian cardiovascular development. It inhibits myoblast differentiation and enhances fibroblast growth factor-induced angiogenesis. Defects in JAG1/Jagged 1 are the cause of Alagille syndrome type 1 (ALGS1). Alagille syndrome is an autosomal dominant multisystem disorder defined clinically by hepatic bile duct paucity and cholestasis in association with cardiac, skeletal, and ophthalmologic manifestations. Defects in JAG1/Jagged 1 are also a cause of tetralogy of Fallot (TOF). TOF is a congenital heart anomaly which consists of pulmonary stenosis, ventricular septal defect, dextroposition of the aorta (aorta is on the right side instead of the left) and hypertrophy of the right ventricle. This condition results in a blue baby at birth due to inadequate oxygenation.
Full Name
jagged 1
References
  • Oda T.et al., 1997, Nat. Genet. 16:235-242.
  • Krantz I.D. et al., 1998, Am. J. Hum. Genet. 62:1361-1369.
  • Li L. et al., 1998, Immunity. 8:43-55.
  • Jones E.A. et al., 2000, J. Med. Genet. 37: 658-662.
  • Roepke A.et al., 2003, Hum. Mutat. 21:100-100.
  • Jurkiewicz D.et al., 2005, Hum. Mutat. 25:321-321.
  • Warthen D.M.et al., 2006, Hum. Mutat. 27:436-443.
  • Jagged 1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Jagged 1 cDNA ORF Clone in Cloning Vector, Rat RG80419-G
    Jagged 1 cDNA ORF Clone, Rat, untagged RG80419-UT
    Jagged 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80419-ACGLN
    Jagged 1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80419-ACG
    Jagged 1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80419-ACR
    Jagged 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80419-CF
    Jagged 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80419-NF
    Jagged 1 cDNA ORF Clone, Rat, C-His tag RG80419-CH
    Jagged 1 cDNA ORF Clone, Rat, N-His tag RG80419-NH
    Jagged 1 cDNA ORF Clone, Rat, C-HA tag RG80419-CY
    Jagged 1 cDNA ORF Clone, Rat, N-HA tag RG80419-NY
    Jagged 1 cDNA ORF Clone, Rat, C-Myc tag RG80419-CM
    Jagged 1 qPCR Primer Pairs, Rat RP300383

    Jagged 1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Jagged 1 cDNA ORF Clone in Cloning Vector, Mouse MG57140-G
    Jagged 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57140-ACGLN

    Jagged 1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Jagged 1 cDNA ORF Clone in Cloning Vector, Human HG11648-M
    Jagged 1 cDNA ORF Clone, Human, untagged HG11648-UT
    Jagged 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11648-ACGLN
    Jagged 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11648-ACG
    Jagged 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11648-ACR
    Jagged 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11648-CF
    Jagged 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11648-NF
    Jagged 1 cDNA ORF Clone, Human, C-His tag HG11648-CH
    Jagged 1 cDNA ORF Clone, Human, N-His tag HG11648-NH
    Jagged 1 cDNA ORF Clone, Human, C-HA tag HG11648-CY
    Jagged 1 cDNA ORF Clone, Human, N-HA tag HG11648-NY
    Jagged 1 cDNA ORF Clone, Human, C-Myc tag HG11648-CM
    Jagged 1 cDNA ORF Clone, Human, N-Myc tag HG11648-NM
    Jagged 1 qPCR Primer Pairs, Human HP100081
    info info
    添加购物车成功! 添加购物车失败!