Kallikrein 13 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Price:
Size:
Number:

Kallikrein 13 cDNA ORF Clone, Rat, C-DDK (Flag®) tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
831 bp
Description
Full length Clone DNA of Rat kallikrein related-peptidase 13 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Kallikrein 13 Background Information

Tissue kallikrein 13 (hK13), also known as KLK-L4 (kallikrein-like gene 4), is a member of the human tissue kallikrein family of serine proteases having diverse physiological functions in many tissues. The KLK13 gene resides on chromosome 19q13.3-4 along with other 14 members in a gene cluster and shares a high degree of homology. KLK13 is a trypsin-like, secreted serine protease expressed specifically in the testicular tissue including prostate, salivary gland, breast, and testis. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and may play a role in metastasis. KLK13 may be involved in the pathogenesis and/or progression of breast and ovary cancers, and is regarded as a novel cancer biomarker. In addition, KLK13 interacts and forms complexes with several serum protease inhibitors, such as alpha2-macroglobulin, and its expression is regulated by steroid hormones.
Full Name
kallikrein-related peptidase 13
References
  • Yousef G.M., et al.,(2000), Identification and characterization of KLK-L4, a new kallikrein-like gene that appears to be down-regulated in breast cancer tissues. J. Biol. Chem. 275:11891-11898.
  • Komatsu N., et al., (2003), Expression and localization of tissue kallikrein mRNAs in human epidermis and appendages.J. Invest. Dermatol. 121:542-549.
  • Andres A.M., et al.,(2007), Understanding the accuracy of statistical haplotype inference with sequence data of known phase.Genet. Epidemiol. 31:659-671.

Kallikrein 13 cDNA ORF Clone, Mouse, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait