Kininogen 1 cDNA ORF Clone, Rat, C-HA tag

Price:
Size:
Number:

Kininogen 1 cDNA ORF Clone, Rat, C-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1293 bp
Description
Full length Clone DNA of Rat kininogen 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Kininogen 1 Background Information

Kininogen-1, also known as high molecular weight kininogen, williams-Fitzgerald-Flaujeac factor, Alpha-2-thiol proteinase inhibitor, Fitzgerald factor, KNG1 and BDK, is a secreted protein which contains threecystatin domains. Kininogen-1 / KNG1 is a protein from the blood coagulation system as well as the kinin-kallikrein system. It is a protein that adsorbs to the surface of biomaterials that come in contact with blood. Kininogen-1 / KNG1 circulates throughout the blood and quickly adsorbs to the material surfaces. Kininogen-1 / KNG1 is one of the early participants of the intrinsic pathway of coagulation, together with Factor XII (Hageman factor) and prekallikrein. Kininogen-1 / KNG1 is one of thekininogens, a class of proteins. As with many other coagulation proteins, the protein was initially named after the patients in whom deficiency was first observed. When the clinical data were combined, it turned out that all patients, in fact, had a deficiency of the same protein. Defects in KNG1 are the cause of high molecular weight kininogen deficiency (HMWK deficiency) which is an autosomal recessive coagulation defect. Patients with HWMK deficiency do not have a hemorrhagic tendency, but they exhibit abnormal surface-mediated activation of fibrinolysis.
Full Name
kininogen 1
References
  • Ohkubo I., et al.,(1984), Isolation of a human cDNA for alpha 2-thiol proteinase inhibitor and its identity with low molecular weight kininogen. Biochemistry 23:5691-5697.
  • Takagaki Y., et al., (1985), Cloning and sequence analysis of cDNAs for human high molecular weight and low molecular weight prekininogens. Primary structures of two human prekininogens.J. Biol. Chem. 260:8601-8609.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.

Kininogen 1 cDNA ORF Clone, Rat, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait