Commande rapide

Rat LAG3/LAG-3/CD223 expression plasmide de Gène l'ADNc ORF clone, C-HA Marqueur

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Rat LAG3 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_212513.2
    Taille du ADNc:1578bp
    Description du ADNc:Full length Clone DNA of Rattus norvegicus lymphocyte-activation gene 3 with C terminal HA tag.
    Synonyme du gène:CD223, MGC108901, Lag3
    Espèces:Rat
    Vecteur:pCMV3-C-HA
    Plasmid:
    Site de restriction:
    Séquence du marqueur:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LAG3 qPCR primers for gene expression analysis, RP300337 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Fond

    LAG3, also known as CD223 and Lymphocyte activation gene 3, belongs to immunoglobulin (Ig) superfamily. LAG3 contains 4 extracellular Ig-like domains. The LAG3 gene contains 8 exons. It is selectively expressed in activated T and NK cells. LAG3 has a negative regulatory function in T cells. It also acts as as a new marker of T cell induced B cell activation. As a soluble molecule, LAG3 activates antigen-presenting cells through MHC class II signalling, leading to increased antigen-specific T-cell responses in vivo.

    Immune Checkpoint
    Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Références
  • Sigrid Hannier. et al., 1998, The Journal of Immunology. 161(8): 4058-65.
  • Triebel F. et al., 1990, J Exp Med. 171 (5): 1393-405.
  • Baixeras E. et al., 1992, J Exp Med. 176 (2): 327-37.
  • Huard B. et al., 1997, Proc Natl Acad Sci. 94 (11): 5744-9.
  • Kisielow M. et al., 2005, Eur J Immunol. 35 (7): 2081-8.
  • Size / Price
    Catalogue : RG80367-CY
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Articles consultés récemment
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »