After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat Galectin-1/LGALS1 expression plasmide de Gène l'ADNc ORF clone

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat LGALS1 Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_019904.1
Taille du ADNc:408bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus lectin, galactoside-binding, soluble, 1.
Synonyme du gène:Lgals1
Espèces:Rat
Vecteur:pCMV3-untagged
Plasmid:
Site de restriction:
Séquence du marqueur:
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fond

Galectin-1 (Gal-1, GAL1), is a member of the galectins, a family of animal lectins ranging from Caenorhabditis elegans to humans, which is defined by their affinity for beta-galactosides and by significant sequence similarity in the carbohydrate-binding site. It is a homodimer with a subunit molecular mass of 14.5 kDa, which contains six cysteine residues per subunit. The cysteine residues should be in a free state in order to maintain a molecular structure that is capable of showing lectin activity. This endogenous lectin widely expressed at sites of inflammation and tumour growth, has been postulated as an attractive immunosuppressive agent to restore immune cell tolerance and homeostasis in autoimmune and inflammatory settings. On the other hand, galectin-1 contributes to different steps of tumour progression including cell adhesion, migration and tumour-immune escape, suggesting that blockade of galectin-1 might result in therapeutic benefits in cancer. Several potential glycoprotein ligands for galectin-1 have been identified, including lysosome-associated membrane glycoproteins and fibronectin, laminin, as well as T-cell glycoproteins CD43 and CD45. Evidence points to Gal-1 and its ligands as one of the master regulators of such immune responses as T-cell homeostasis and survival, T-cell immune disorders, inflammation and allergies as well as host-pathogen interactions.

Références
  • Gaudet AD, et al. (2005) Expression and functions of galectin-1 in sensory and motoneurons. Curr Drug Targets. 6(4): 419-25.
  • Kadoya T, et al. (2006) Structural and functional studies of galectin-1: a novel axonal regeneration-promoting activity for oxidized galectin-1. Curr Drug Targets. 6(4): 375-83.
  • Camby I, et al. (2006) Galectin-1: a small protein with major functions. Glycobiology. 16(11): 137R-157R.
  • Salatino M, et al. (2008) Galectin-1 as a potential therapeutic target in autoimmune disorders and cancer. Expert Opin Biol Ther. 8(1): 45-57.
  • Size / Price
    Catalogue : RG80248-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »