Commande rapide

Rat MDHA / MDH1 expression plasmide de Gène l'ADNc ORF clone

    Fiche techniqueCommentairesProduits apparentésProtocoles
    Rat MDH1 Informations sur les produits clonés de cDNA
    Gene_bank_ref_id:NM_033235.1
    Taille du ADNc:1005bp
    Description du ADNc:Full length Clone DNA of Rattus norvegicus malate dehydrogenase 1, NAD (soluble).
    Synonyme du gène:MDL1, Mdhl, Mor2, Mdh1
    Espèces:Rat
    Vecteur:pCMV3-untagged
    Plasmid:
    Site de restriction:
    Séquence du marqueur:
    Description de la séquence:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MDH1 qPCR primers for gene expression analysis, RP300219 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Stockage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Fond

    Malate dehydrogenases 1(MDH1 / MDHA) is soluable form of malate dehydrogenases. Malate dehydrogenases (MDH) is a group of multimeric enzymes consisting of identical subunits usually organized as either dimer or tetramers with subunit molecular weights of 30-35 kDa. MDH has been isolated from different sources including archaea, eubacteria, fungi, plant and mammals. MDH catalyzes the NAD/NADH-dependent interconversion of the substrates malate and oxaloacetate. This reaction plays a key part in the malate / aspartate shuttle across the mitochondrial membrane, and in the tricarboxylic acid cycle within the mitochondrial matrix. The enzymes share a common catalytic mechanism and their kinetic properties are similar, which demonstrates a high degree of structural similarity. The three-dimensional structures and elements essential for catalysis are conserved between mitochondrial and cytoplasmic forms of MDH in eukaryotic cells even though these isoenzymes are only marginally related at the level of primary structure. 

    Références
  • Minarik P, et al. (2002) Malate dehydrogenases--structure and function. Gen Physiol Biophys. 21 (3): 257-65.
  • Musrati RA, et al. (1998) Malate dehydrogenase: distribution, function and properties. Gen Physiol Biophys. 17 (3): 193-210.
  • Hall MD, et al. (1992) Crystal structure of Escherichia coli malate dehydrogenase. A complex of the apoenzyme and citrate at 1.87 A resolution. J Mol Biol. 226 (3): 867-82.
  • Size / Price
    Catalogue : RG80232-UT
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité
    Ajouter au panierBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »