MMADHC/C2ORF25 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81096-CM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All MMADHC/C2ORF25 Reagents

CRO Services

Product recommended


All MMADHC/C2ORF25 Reagents

MMADHC/C2ORF25 cDNA ORF Clone, Rat, C-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
891 bp
Description
Full length Clone DNA of Rat methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MMADHC/C2ORF25 Background Information

Full Name
methylmalonic aciduria (cobalamin deficiency) cblD type, with homocystinuria
Research Areas

MMADHC/C2ORF25 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MMADHC/C2ORF25 cDNA ORF Clone in Cloning Vector, Rat RG81096-U
MMADHC/C2ORF25 cDNA ORF Clone, Rat, untagged RG81096-UT
MMADHC/C2ORF25 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81096-ACGLN
MMADHC/C2ORF25 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81096-ACG
MMADHC/C2ORF25 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81096-ANG
MMADHC/C2ORF25 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81096-ACR
MMADHC/C2ORF25 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81096-ANR
MMADHC/C2ORF25 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81096-CF
MMADHC/C2ORF25 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81096-NF
MMADHC/C2ORF25 cDNA ORF Clone, Rat, C-His tag RG81096-CH
MMADHC/C2ORF25 cDNA ORF Clone, Rat, N-His tag RG81096-NH
MMADHC/C2ORF25 cDNA ORF Clone, Rat, C-HA tag RG81096-CY
MMADHC/C2ORF25 cDNA ORF Clone, Rat, N-HA tag RG81096-NY
MMADHC/C2ORF25 cDNA ORF Clone, Rat, N-Myc tag RG81096-NM
MMADHC/C2ORF25 qPCR Primer Pairs, Rat RP301053

MMADHC/C2ORF25 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MMADHC/C2ORF25 cDNA ORF Clone in Cloning Vector, Mouse MG53862-U
MMADHC/C2ORF25 cDNA ORF Clone, Mouse, untagged MG53862-UT
MMADHC/C2ORF25 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53862-ACG
MMADHC/C2ORF25 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53862-ACGLN
MMADHC/C2ORF25 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53862-ANG
MMADHC/C2ORF25 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53862-ACR
MMADHC/C2ORF25 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53862-ANR
MMADHC/C2ORF25 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53862-CF
MMADHC/C2ORF25 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53862-NF
MMADHC/C2ORF25 cDNA ORF Clone, Mouse, C-His tag MG53862-CH
MMADHC/C2ORF25 cDNA ORF Clone, Mouse, N-His tag MG53862-NH
MMADHC/C2ORF25 cDNA ORF Clone, Mouse, C-HA tag MG53862-CY
MMADHC/C2ORF25 cDNA ORF Clone, Mouse, N-HA tag MG53862-NY
MMADHC/C2ORF25 cDNA ORF Clone, Mouse, C-Myc tag MG53862-CM
MMADHC/C2ORF25 cDNA ORF Clone, Mouse, N-Myc tag MG53862-NM

MMADHC/C2ORF25 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MMADHC/C2ORF25 cDNA ORF Clone in Cloning Vector, Human HG16947-U
MMADHC/C2ORF25 cDNA ORF Clone, Human, untagged HG16947-UT
MMADHC/C2ORF25 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16947-ACGLN
MMADHC/C2ORF25 cDNA ORF Clone, Human, C-GFPSpark® tag HG16947-ACG
MMADHC/C2ORF25 cDNA ORF Clone, Human, N-GFPSpark® tag HG16947-ANG
MMADHC/C2ORF25 cDNA ORF Clone, Human, C-OFPSpark® tag HG16947-ACR
MMADHC/C2ORF25 cDNA ORF Clone, Human, N-OFPSpark® tag HG16947-ANR
MMADHC/C2ORF25 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16947-CF
MMADHC/C2ORF25 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16947-NF
MMADHC/C2ORF25 cDNA ORF Clone, Human, C-His tag HG16947-CH
MMADHC/C2ORF25 cDNA ORF Clone, Human, N-His tag HG16947-NH
MMADHC/C2ORF25 cDNA ORF Clone, Human, C-HA tag HG16947-CY
MMADHC/C2ORF25 cDNA ORF Clone, Human, N-HA tag HG16947-NY
MMADHC/C2ORF25 cDNA ORF Clone, Human, C-Myc tag HG16947-CM
MMADHC/C2ORF25 cDNA ORF Clone, Human, N-Myc tag HG16947-NM
info info
添加购物车成功! 添加购物车失败!