Nicastrin cDNA ORF Clone, Rat, C-HA tag

Price:
Size:
Number:

Nicastrin cDNA ORF Clone, Rat, C-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2127 bp
Description
Full length Clone DNA of Rat nicastrin with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Nicastrin Background Information

Nicastrin (NCST, or NCT), a single-pass membrane glycoprotein that harbors a large extracellular domain, is an essential component of the gamma-secretase complex. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes. Increasing evidences have shown that Nicastrin/NCSTN plays a crucial role in gamma-cleavage of the amyloid precursor protein (APP). The glycoprotein Nicastrin is an essential component of the gamma-secretase complex, a high molecular weight complex which also contains the presenilin proteins, Aph-1 and Pen-2. The gamma-secretase complex is not only involved in APP processing but also in the processing of an increasing number of other type I integral membrane proteins. As the largest subunit of the gamma-secretase complex, Nicastrin plays a crucial role in its activation. Inhibition of NCSTN demonstrated an altered gamma-cleavage activity, suggesting its potential implication in developing Alzheimer's disease (AD). In addition, Nicastrin can function to maintain epithelial to mesenchymal transition during breast cancer progression. Anti-nicastrin polyclonal and monoclonal antibodies were able to decrease notch1 and vimentin expression and reduced the invasive capacity of breast cancer cells in vitro.
Full Name
nicastrin
References
  • He G, et al. (2007) Degradation of nicastrin involves both proteasome and lysosome. J Neurochem. 101(4): 982-92.
  • Hayashi I, et al. (2009) Single chain variable fragment against nicastrin inhibits the gamma-secretase activity. J Biol Chem. 284(41): 27838-47.
  • Ma Z, et al. (2009) Association between promoter polymorphisms of the nicastrin gene and sporadic Alzheimer's disease in North Chinese Han population. Neurosci Lett. 458(3): 136-9.
  • Pardossi-Piquard R, et al. (2009) p53-dependent control of cell death by nicastrin: lack of requirement for presenilin-dependent gamma-secretase complex. J Neurochem. 109(1): 225-37.
  • Filipovi? A, et al. (2011) Biological and clinical implications of nicastrin expression in invasive breast cancer. Breast Cancer Res Treat. 125(1): 43-53.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait