Commande rapide

Text Size:AAA

Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat NGP Informations sur les produits clonés de cDNA
Taille du ADNc:507bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus neutrophilic granule protein with N terminal Myc tag.
Synonyme du gène:Ngp
Site de restriction:
Séquence du marqueur:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Description de la séquence:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF clone, N-Myc Marqueur on other vectors
Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF clone, C-GFPSpark MarqueurRG80705-ACGCHF270
Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF clone, C-OFPSpark MarqueurRG80705-ACRCHF270
Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF clone, N-GFPSpark MarqueurRG80705-ANGCHF270
Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF clone, N-OFPSpark MarqueurRG80705-ANRCHF270
Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF clone, C-Flag MarqueurRG80705-CFCHF230
Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF clone, C-His MarqueurRG80705-CHCHF230
Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF clone, C-Myc MarqueurRG80705-CMCHF230
Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF clone, C-HA MarqueurRG80705-CYCHF230
Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF clone, N-Flag MarqueurRG80705-NFCHF230
Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF clone, N-His MarqueurRG80705-NHCHF230
Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF clone, N-Myc MarqueurRG80705-NMCHF230
Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF clone, N-HA MarqueurRG80705-NYCHF230
Rat NGP/neutrophilic granule Protéine Gène ADNc clone le vecteur de clonageRG80705-UCHF90
Rat NGP/neutrophilic granule Protéine expression plasmide de Gène l'ADNc ORF cloneRG80705-UTCHF230
 En savoir plus sur les vecteurs d'expression
Product nameProduct name
Size / Price
Catalogue : RG80705-NM
Prix catalogue : 
Prix :      (You Save: )
Taille :
Quantité :+-
Disponibilité2-3 weeks
Bulk Discount RequiryAjouter au panier
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.