After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat CD73/NT5E expression plasmide de Gène l'ADNc ORF clone, N-His Marqueur

Fiche techniqueCommentairesProduits apparentésProtocoles
Rat NT5E Informations sur les produits clonés de cDNA
Gene_bank_ref_id:NM_021576.2
Taille du ADNc:1731bp
Description du ADNc:Full length Clone DNA of Rattus norvegicus 5' nucleotidase, ecto with N terminal His tag.
Synonyme du gène:Nt5, CD73, MGC112615, Nt5e
Espèces:Rat
Vecteur:pCMV3-SP-N-His
Plasmid:
Site de restriction:
Séquence du marqueur:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Description de la séquence:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Stockage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fond

5'-nucleotidase, also known as NT5E, NTE, and CD73, is a cell membrane protein which belongs to the 5'-nucleotidase family. CD73 is a glycosyl phosphatidylinositol (GPI) anchored purine salvage enzyme expressed on the surface of human T and B lymphocytes. CD73 catalyzes the conversion of purine and pyrimidine ribo- and deoxyribonucleoside monophosphates to the corresponding nucleosides. CD73 serves as a costimulatory molecule in activating T cells. CD73 generated adenosine functions in cell signalling in many physiologic systems, including intestinal epithelium, ischemic myocardium, and cholinergic synapses. CD73 might mediate lymphocyte-stromal cell interactions or condition the local microenvironment to facilitate lymphocyte development and/or function. In CD73-depleted cells, surface levels of the leukocyte adhesion molecules ICAM-1, VCAM-1 and E-selectin increase. CD73 produces extracellular adenosine, which then acts on G protein-coupled purigenic receptors to induce cellular responses. CD73 has also been reported to regulate expression of pro-inflammatory molecules in mouse endothelium.

Références
  • Resta R. et al., 1997, Cell Signal. 9 (2): 131-9.
  • Yamashita Y. et al., 1998, Eur J Immunol. 28 (10): 2981-90.
  • Louis NA. et al., 2008, J Immunol. 180 (6): 4246-55.
  • Grünewald JK. et al., 2010, J Inflamm. 7 (1): 10.
  • Size / Price
    Catalogue : RG80335-NH
    Prix catalogue : 
    Prix :      (You Save: )
    Taille :
    Quantité :+-
    Disponibilité2-3 weeks
    Bulk Discount RequiryAjouter au panier
    Contact Us
    Images
        Articles consultés récemment
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Veuillez noter : Tous les produits sont « DESTINÉS À LA RECHERCHE UNIQUEMENT ET NE SONT PAS PRÉVUS POUR ÊTRE UTILISÉS À DES FINS DE DIAGNOSTIC OU THÉRAPEUTIQUES »